View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14426_high_5 (Length: 237)

Name: NF14426_high_5
Description: NF14426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14426_high_5
NF14426_high_5
[»] chr5 (1 HSPs)
chr5 (19-144)||(14546569-14546698)


Alignment Details
Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 19 - 144
Target Start/End: Original strand, 14546569 - 14546698
Alignment:
19 tatcatgaaaagaagagcattgctgaggcttgaattgttgtatggctgtggtagaatgcagtagaaaaggttcaaaatttgcttgtaatg----gataac 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||    ||||||    
14546569 tatcatgaaaagaagagcattgctgaggcttgaattgttgtatggctgtggtagaatgcagtagaaaaggttcaaaatttgtttgtgatggatagataac 14546668  T
115 attggaatggtacatgtacatcaacatgca 144  Q
    ||||||||||||||||||||||||||||||    
14546669 attggaatggtacatgtacatcaacatgca 14546698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University