View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14426_low_2 (Length: 323)
Name: NF14426_low_2
Description: NF14426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14426_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 21 - 260
Target Start/End: Original strand, 10170904 - 10171143
Alignment:
| Q |
21 |
ccaggtaatgatcctttctatttactatttcaaagcatagcattgttcaaggaattaattcatataaaccgtcggtgtaaaaaagttttataccatcaat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10170904 |
ccaggtaatgatcctttctatttactatttcatagcatagcattgttcaaggaattaattcatataaaccgtcggtgtgaaaaagttttataccatcaat |
10171003 |
T |
 |
| Q |
121 |
gactcaaaaacgtatcattagatacatttgatttttatcactctcatttttaaagttacacacgtagttgattgtgatacgttgacaatgtaaaacttac |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
10171004 |
gactcaaaaacgtatcattagatacatttgatttttatcactctcatttttaaagttacactcgtagttgattgtgatacattgacaatgtaaaatttac |
10171103 |
T |
 |
| Q |
221 |
gtgaaaatttaaccccgttaaaatgtaagatatttttttt |
260 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10171104 |
gtgaaaatttaaccccgtaaaaatgtaagatatttttttt |
10171143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University