View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14426_low_6 (Length: 237)
Name: NF14426_low_6
Description: NF14426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14426_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 19 - 144
Target Start/End: Original strand, 14546569 - 14546698
Alignment:
| Q |
19 |
tatcatgaaaagaagagcattgctgaggcttgaattgttgtatggctgtggtagaatgcagtagaaaaggttcaaaatttgcttgtaatg----gataac |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| |||||| |
|
|
| T |
14546569 |
tatcatgaaaagaagagcattgctgaggcttgaattgttgtatggctgtggtagaatgcagtagaaaaggttcaaaatttgtttgtgatggatagataac |
14546668 |
T |
 |
| Q |
115 |
attggaatggtacatgtacatcaacatgca |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
14546669 |
attggaatggtacatgtacatcaacatgca |
14546698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University