View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14427_high_6 (Length: 410)
Name: NF14427_high_6
Description: NF14427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14427_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 2e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 18 - 206
Target Start/End: Original strand, 27403699 - 27403886
Alignment:
| Q |
18 |
tatatataggatcatcctagctagctacattttcaaagttgagagtcttgatatcgaaatacacagaaagtgagataaaacctaaaaccgataatcatgt |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27403699 |
tatatataggatcatc-tagctagctacattttcaaagttgagagtcttgatattgaaatacacagaaagtgagataaaacctaaaaccgataatcatgt |
27403797 |
T |
 |
| Q |
118 |
ccctcaattagggtaatgcttatgggatggggtggaattggaaactgaaaagcaaggaagaaaatatgataagctgtctctgaaggtta |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27403798 |
ccctcaattagggtaatgcttatgggatggggtggaattggaagctgaaaagcaaggaagaaaatatgatcagctgtctctgaaggtta |
27403886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University