View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14427_low_11 (Length: 365)
Name: NF14427_low_11
Description: NF14427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14427_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 15 - 347
Target Start/End: Original strand, 2811089 - 2811421
Alignment:
| Q |
15 |
cataggtctgatatactttctgttcctaattggtttagagatggacatatctattgtgaaacgcaccggtgcaaaggcggtgtccattgcagttgctggt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2811089 |
cataggtctgatatactttctgttcctaattggtttagagatggacatatctattgtgaaacgcaccggtgcaaaggcggtgtccattgcagttgctggt |
2811188 |
T |
 |
| Q |
115 |
atgatattgccctttattgttggtttgggagtctcctttgctttcactgatagagatgaaagtgtaaatgacttcagctttgttctctatcttggtattg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2811189 |
atgatattgccctttattgttggtttgggagtctcctttgctttcactggtagagatgaaagtgtaaatgacttcagctttgttctctatcttggtattg |
2811288 |
T |
 |
| Q |
215 |
ttctatctgtcacctcatttcctgtgctcgctcgaatgcttgccgagctcaaactcatcaacacagaactaggaaagctttcactttcaacttccctcat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2811289 |
ttctatctgtcacctcatttcctgtgctcgctcgaatgcttgccgagctcaaactcatcaacacagaactaggaaagctttcactttcaacttccctcat |
2811388 |
T |
 |
| Q |
315 |
caatgatgtgtgtgcttggattttattagctct |
347 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
2811389 |
caatgatgtgtgtgcttggcttttattagctct |
2811421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 220 - 336
Target Start/End: Complemental strand, 44056208 - 44056092
Alignment:
| Q |
220 |
tctgtcacctcatttcctgtgctcgctcgaatgcttgccgagctcaaactcatcaacacagaactaggaaagctttcactttcaacttccctcatcaatg |
319 |
Q |
| |
|
|||||||| |||||||||| || ||| | || || |||||||| ||||||||||||||||| ||||||||||| | ||||| || | ||||||| || |
|
|
| T |
44056208 |
tctgtcactgcatttcctgttctagctaggatcctcgccgagctaaaactcatcaacacagatataggaaagcttgctctttcggctgcactcatcagtg |
44056109 |
T |
 |
| Q |
320 |
atgtgtgtgcttggatt |
336 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
44056108 |
atgtgtgtgcttggatt |
44056092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University