View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14427_low_13 (Length: 348)
Name: NF14427_low_13
Description: NF14427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14427_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-137; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 83 - 342
Target Start/End: Complemental strand, 42677514 - 42677255
Alignment:
| Q |
83 |
ttagacaaagctgtatgaattaacctccccttacaatatttttcaattgatggctagcgtggttcataatagaatcggtacaaacacttaaaaaacaaac |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42677514 |
ttagacaaagctgtatgaattaacctccccttacaatatttttcaattgatggctagcgtggttcacaatagaatcggtacaaacacttaaaaaacaaac |
42677415 |
T |
|
| Q |
183 |
atggcgtgaacatgttctgaaggtaccacgaaaacatgtagtatatatgtgttcacaaagcaaataattgtgcatagtatcggcaacaattttgctacct |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42677414 |
atggcgtgaacatgttctgaaggtaccacgaaaacatgtagtatatatgtgttcaaaaagcaaataattgtgcatagtatcggcaacaattttgctacct |
42677315 |
T |
|
| Q |
283 |
caggattcaaattctacgaaccaaaaatgtcttgattttctggtggaaattctcaatctc |
342 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42677314 |
caggattcaaattctatgaaccaaaaatgtcttgattttctggtggaaattctcaatctc |
42677255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 231 - 322
Target Start/End: Complemental strand, 52835123 - 52835029
Alignment:
| Q |
231 |
gtgttcacaaagcaaataattgtgcatagtatcggcaacaa-ttttgctacctcag--gattcaaattctacgaaccaaaaatgtcttgattttc |
322 |
Q |
| |
|
||||||| | ||||||||||||||||||||||| ||||||| |||||||||||||| ||||||||||||| ||| | ||||||||||||||||| |
|
|
| T |
52835123 |
gtgttcaaagagcaaataattgtgcatagtatcagcaacaatttttgctacctcaggagattcaaattctatgaagccaaaatgtcttgattttc |
52835029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 33 - 66
Target Start/End: Complemental strand, 42677553 - 42677520
Alignment:
| Q |
33 |
acatcatcaccacaaacaaaactcaccgtcacat |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42677553 |
acatcatcaccacaaacaaaactcaccgtcacat |
42677520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 189 - 275
Target Start/End: Original strand, 48968805 - 48968887
Alignment:
| Q |
189 |
tgaacatgttctgaaggtaccacgaaaacatgtagtatatatgtgttcacaaagcaaataattgtgcatagtatcggcaacaatttt |
275 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||| ||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48968805 |
tgaacatgttctgaaggtaccacaaaaacctgtagtag----gtgttcaaaaagcaaataattgtgcatagtatcagcaacaatttt |
48968887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 33 - 66
Target Start/End: Original strand, 15496097 - 15496130
Alignment:
| Q |
33 |
acatcatcaccacaaacaaaactcaccgtcacat |
66 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
15496097 |
acatcatcaccacaaacaaaactcaccgccacat |
15496130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 286 - 322
Target Start/End: Original strand, 48968994 - 48969030
Alignment:
| Q |
286 |
gattcaaattctacgaaccaaaaatgtcttgattttc |
322 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
48968994 |
gattcaaattctatgaacccaaaatgtcttgattttc |
48969030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 33 - 66
Target Start/End: Original strand, 6705719 - 6705752
Alignment:
| Q |
33 |
acatcatcaccacaaacaaaactcaccgtcacat |
66 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
6705719 |
acatcatcaccacaaacaaaactcaccgccacat |
6705752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 33 - 66
Target Start/End: Original strand, 40900403 - 40900436
Alignment:
| Q |
33 |
acatcatcaccacaaacaaaactcaccgtcacat |
66 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
40900403 |
acatcatcaccacaaacaaaactcaccgccacat |
40900436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 94 - 142
Target Start/End: Original strand, 40900464 - 40900512
Alignment:
| Q |
94 |
tgtatgaattaacctccccttacaatatttttcaattgatggctagcgt |
142 |
Q |
| |
|
||||||||| |||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
40900464 |
tgtatgaatgaacctccctttgcaatatttcccaattgatggctagcgt |
40900512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University