View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14427_low_14 (Length: 338)
Name: NF14427_low_14
Description: NF14427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14427_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 6e-99; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 21 - 207
Target Start/End: Complemental strand, 4979598 - 4979412
Alignment:
| Q |
21 |
gggggctatgataaaaattaaacaatgcaatgctacctaacatttactttcggcacttagatttgatttgtgcataaggataaaccaaaatcaagataag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4979598 |
gggggctatgataaaaattaaacaatgcaatgctacctaacatttactttcggcacttagatttgatttgtgcataaggataaaccaaaatcaagataag |
4979499 |
T |
|
| Q |
121 |
ctacatgcaatcaatgttaattaaaggcattaattcaatatctacagtctatacctaaaccattatgttgggtcaaatagtcaaaat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4979498 |
ctacatgcaatcaatgttaattaaaggcattacttcaatatctacagtctatacctaaaccattatgttgggtcaaatagtcaaaat |
4979412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 290 - 322
Target Start/End: Complemental strand, 4979414 - 4979382
Alignment:
| Q |
290 |
aatacctggagctatgtatccatatgaaccagc |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4979414 |
aatacctggagctatgtatccatatgaaccagc |
4979382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University