View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14427_low_19 (Length: 283)
Name: NF14427_low_19
Description: NF14427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14427_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 29 - 262
Target Start/End: Complemental strand, 37924228 - 37923988
Alignment:
| Q |
29 |
agatcttattatgaagcattgtggtacagagattctcaatggcccaaatatagcaatggatacatcatatgccatggtgacta-------caatctatac |
121 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37924228 |
agatcttataatgaagcattgtgttacagagattctcaatggcccaaatatagcaatggatacatcatatgccatggtgactagtgactacaatctatac |
37924129 |
T |
 |
| Q |
122 |
ccttattatgcggggaatctctgactctgaaacaaaataaaatccatgaaaacattagccagataagaaatagtcgaggttttgttctttcctttcaacg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37924128 |
ccttattatgcggggaatctctgactctgaaacaaaataaaatccatgaaaacattagccagataagaaatagtcgaggttttgttctttcctttcaacg |
37924029 |
T |
 |
| Q |
222 |
ttatatgtatacatgcaactaggctagttggtatttgtcgt |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37924028 |
ttatatgtatacatgcaactaggctagttggtatttgtcgt |
37923988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University