View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14427_low_21 (Length: 246)
Name: NF14427_low_21
Description: NF14427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14427_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 34187213 - 34186977
Alignment:
| Q |
1 |
accagtcctttctacctgtcatatggttgctacagcctgaatcgatgaaccacatgtcttgtgtatttgattctccatctgatgaaagttgtgccatgag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34187213 |
accagtcctttctacctgtcatatggttgctgcagcctgaatcgatgaaccacatgtcttgtgtatttgattctccatctgatgaaagttgtgccatgag |
34187114 |
T |
 |
| Q |
101 |
tagcactgcttcctcgttggtctcagcataatttgcggtgttgttcaggggtttatttgggcattcatactggaaatgtccaaactcatggcaataataa |
200 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34187113 |
tagcattgcttcctcgttggtctcaacataatttgcggtgttgttcaggggtttatttgggcattcatactggaaatgtccaaactcatggcaataataa |
34187014 |
T |
 |
| Q |
201 |
cactccactgctgcctttcctcctctacctcctttgc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34187013 |
cactccactgctgcctttcctcctctacctcctttgc |
34186977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University