View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14427_low_5 (Length: 452)
Name: NF14427_low_5
Description: NF14427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14427_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 359; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 359; E-Value: 0
Query Start/End: Original strand, 8 - 370
Target Start/End: Original strand, 14002800 - 14003162
Alignment:
| Q |
8 |
cagcagagaaaggagagagatgcaaaagatgcagcatttgttaaagtagataataaaattagagcactttctgaggtgattataaggatgagaatggaag |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14002800 |
cagcagagaaaggagagagatgcaaaagatgcagcatttgttaaagtagataacaaaattagagcactttctgaggtgattataaggatgagaatggaag |
14002899 |
T |
 |
| Q |
108 |
gaggaactaaaattgaaatcaaggaggttaacaaagaagcaaataaaaagggttgtgcttttacaccaaattttagacccaaaaaatgtttgaaagaagt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14002900 |
gaggaactaaaattgaaatcaaggaggttaacaaagaagcaaataaaaagggttgtgcttttacaccaaattttagacccaaaaaatgtttgaaagaagt |
14002999 |
T |
 |
| Q |
208 |
taagaagattgattgggagaagagtttaagggcaggttcaagccctgttcctgtgaaaggatcatatgttagatcaaagcaaaaggataaaataatgatg |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14003000 |
taagaagattgattgggagaagagtttaagggcaggttcaagccctgttcctgtgaaaggatcatatgttagatcaaagcaaaaggataaaataatgatg |
14003099 |
T |
 |
| Q |
308 |
aggggaaaaaatgcaagtgaggataagaagctacttcaattggtgtggaaggtttaaagctca |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14003100 |
aggggaaaaaatgcaagtgaggataagaagctacttcaattggtgtggaaggtttaaagctca |
14003162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University