View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14428_high_36 (Length: 279)
Name: NF14428_high_36
Description: NF14428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14428_high_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 51 - 266
Target Start/End: Complemental strand, 54730159 - 54729944
Alignment:
| Q |
51 |
ggatgtagtgtttgcaaactctaacaaaagtgattgataggatatttgcacttacgaactataacatgctcaggttttataaatttagtattataaatta |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
54730159 |
ggatgtagtgtttgcaaactctaacaaaagtgattgataggatatttgcacttacgaactataacatgctcaggttttataaatttcgtaatataaatta |
54730060 |
T |
|
| Q |
151 |
attacagcatgcatctatttaaaaatgaaatgagttattttatttttcaaagcttcacatgtaagaaattggcttcaaattgtggattcaatttatctgc |
250 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54730059 |
attgcagcatgcatctatttaaaaatgaaatgagttattttatttttcaaagcttcacatgtaagaaattggcttcaaattgtggattcaatttatctgc |
54729960 |
T |
|
| Q |
251 |
tttccctcttttgatg |
266 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
54729959 |
tttccctcttttgatg |
54729944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University