View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14428_high_42 (Length: 256)
Name: NF14428_high_42
Description: NF14428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14428_high_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 43701940 - 43701831
Alignment:
| Q |
1 |
ccattcatctctttttgatattgtcgtttccattgttgcgatcattgttcatccaacttcataattgatttgaccaatgatttgtgggctcaatagcaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43701940 |
ccattcatctctttttgatattgtcgtttccattgttgcgatcattgttcatccaacttcataattgatttgaccaatgatttgtgggctcaatagcaag |
43701841 |
T |
 |
| Q |
101 |
gtaatgtgca |
110 |
Q |
| |
|
| |||||||| |
|
|
| T |
43701840 |
gcaatgtgca |
43701831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 172 - 247
Target Start/End: Complemental strand, 43701769 - 43701694
Alignment:
| Q |
172 |
gccataggtagaggttctagcaggccaccatttacattatgttttgcattttgtagtgtggtccatatgatgatgt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43701769 |
gccataggtagaggttctagcaggccaccatttacattatgttttgcattttgtagtgtggtccatatgatgatgt |
43701694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University