View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14428_high_47 (Length: 246)
Name: NF14428_high_47
Description: NF14428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14428_high_47 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 126; Significance: 4e-65; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 18 - 183
Target Start/End: Complemental strand, 21275103 - 21274938
Alignment:
| Q |
18 |
gtcacgatgtccatgtcaatatcatgtttgtttaccgattaacaagcaacagaaatgtcgaagacaatttaacttcatttgaaatataacttctacattt |
117 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
21275103 |
gtcacgatgtttatgttaatatcatgtttgtttacggattaacaagcaatagaaatgtcgaagacaatttaacttcattagaaatataacttctgcattt |
21275004 |
T |
|
| Q |
118 |
cctcttgagtaattaatttctctttccttttatgtaacctcaaatgaatgattgccaatgcatgtt |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| ||||| |
|
|
| T |
21275003 |
cctcttgagtaattaatttctctttccttttatgtaaccttaaatgattgattgccaatgtatgtt |
21274938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 128 - 190
Target Start/End: Complemental strand, 21110187 - 21110129
Alignment:
| Q |
128 |
aattaatttctctttccttttatgtaacctcaaatgaatgattgccaatgcatgtttgatagt |
190 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||| |||| ||||||||||||| |
|
|
| T |
21110187 |
aattgatttctctttccttttatgtaacctcaa----atgattgtcaatacatgtttgatagt |
21110129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 180
Target Start/End: Complemental strand, 21178065 - 21177993
Alignment:
| Q |
108 |
ttctacatttcctcttgagtaattaatttctctttccttttatgtaacctcaaatgaatgattgccaatgcat |
180 |
Q |
| |
|
||||||||||||| || | |||||||||| ||||||| |||||||||||||| || || |||||||||||| |
|
|
| T |
21178065 |
ttctacatttcctattaacaaattaatttcaatttccttctatgtaacctcaaacgattgcttgccaatgcat |
21177993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University