View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14428_high_48 (Length: 239)
Name: NF14428_high_48
Description: NF14428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14428_high_48 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 24 - 219
Target Start/End: Original strand, 22796161 - 22796356
Alignment:
| Q |
24 |
gttacatcattcatttgcttccactttgtcaaattataactggtgtctgcatgtcggtgttattgacattgtcgtgcctggtgtccatgtctatgtcggt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22796161 |
gttacatcattcatttgcttccactttgtcaaattataactggtgtctacatgtcggtgttattgacattgtcgtgcctggtgtccatgtctatgtcggt |
22796260 |
T |
|
| Q |
124 |
gctccgtatgtagtatgttattttccatttaccacagaaactaaggttaacttgtttcaattttccttttatgtttaatagggagaggtacagtat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22796261 |
gctccgtatgtagtatgttattttccatttaccacagaaacaaaggttaacttgtttcaattttccttttatgtttaatagggagaggtacagtat |
22796356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University