View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14428_high_54 (Length: 217)

Name: NF14428_high_54
Description: NF14428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14428_high_54
NF14428_high_54
[»] chr8 (1 HSPs)
chr8 (51-204)||(1521364-1521516)


Alignment Details
Target: chr8 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 51 - 204
Target Start/End: Complemental strand, 1521516 - 1521364
Alignment:
51 atattcaaacgttataacaataaatattttcattagttttgatatgttttccgttttcttttaataat---tggtattaatattgaccatagacctaacc 147  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||    
1521516 atattcaaacgttataacaataaatattttcattagttttgatatgttttccgttttcttttaataataattggtattaatattgaccatagacctaacc 1521417  T
148 atgtatactataacgttcgtaacagtcagtccggcaacaaaattcacatgtattatg 204  Q
    ||| |||||||||||||||||||||||    | | ||||||||||||||||||||||    
1521416 atgcatactataacgttcgtaacagtc----cagtaacaaaattcacatgtattatg 1521364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University