View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14428_high_58 (Length: 201)
Name: NF14428_high_58
Description: NF14428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14428_high_58 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 8e-60; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 55 - 183
Target Start/End: Original strand, 22273336 - 22273464
Alignment:
| Q |
55 |
ggcaaaaaatatccaaataaacatttgattattaggtatcagtctcaaatttttaaattgagtatatcgaagaaatcttccacaagcggcatcgtcagat |
154 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
22273336 |
ggcaacaaatatcccaataaacatttgattattaggtatcagtctcaaatttttaaattgagtatatcaaagaaatcttccacaagcggcatcgtcagat |
22273435 |
T |
|
| Q |
155 |
ttcaccaaaattgcaaaatggaggacaat |
183 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22273436 |
ttcaccaaaattgcaaaatggaggacaat |
22273464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 8e-26
Query Start/End: Original strand, 61 - 180
Target Start/End: Original strand, 22267153 - 22267271
Alignment:
| Q |
61 |
aaatatccaaataaacatttgattattaggtatcagtctcaaatttttaaattgagtatatcgaagaaatcttccacaagcggcatcgtcagatttcacc |
160 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||| ||||||||||||||| |||||| ||| ||| ||||||| || |||| ||| ||||||||||| | |
|
|
| T |
22267153 |
aaatatccgaataaacatttgattattaggtttcaatctcaaatttttaaa-tgagtagatcaaaggaatcttcaaccagcgacatagtcagatttcaac |
22267251 |
T |
|
| Q |
161 |
aaaattgcaaaatggaggac |
180 |
Q |
| |
|
|||| ||||||||| ||||| |
|
|
| T |
22267252 |
aaaaatgcaaaatgaaggac |
22267271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 70 - 118
Target Start/End: Original strand, 22257889 - 22257937
Alignment:
| Q |
70 |
aataaacatttgattattaggtatcagtctcaaatttttaaattgagta |
118 |
Q |
| |
|
|||||| || |||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
22257889 |
aataaatatatgattattagctttcagtctcaaatttttaaattgagta |
22257937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University