View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14428_high_9 (Length: 529)
Name: NF14428_high_9
Description: NF14428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14428_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 338; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 17 - 390
Target Start/End: Complemental strand, 28697917 - 28697543
Alignment:
| Q |
17 |
ataaaatcagtaaagaactagcataacata-catttgtttcatttatgcagcctgactcactttacaatacatctcaaatcttccatgtctaaaaaccat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28697917 |
ataaaatcagtaaagaactagcataacataacatttgtttcatttatgcagcctgactcactttacaatacatctcaaatcttccatgtctaaaaaccat |
28697818 |
T |
|
| Q |
116 |
attcatcaacaaaaattaatctacctatttcctaaacnnnnnnngggaacaaggcaaaacatcatcatcaaccatgaaactggtagacaaggtccaatgc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28697817 |
attcatcaacaaaaattaatctacctatttcctaaacaaaaaaagggaacaaagcaaaacatcatcatcaaccatgaaactggtagacaaggtccaatgc |
28697718 |
T |
|
| Q |
216 |
cctcaacttaacagcatgtggatcataatccttaacaaacccatcattggataatcgcttctcctctacccgggccgccgcagacggcgacaagggccgt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28697717 |
cctcaacttaacagcatgtggatcataatccttaacaaacccatcattggataatcgcttctcctctacccgggccgccgcagacggcgacaagggccgt |
28697618 |
T |
|
| Q |
316 |
tttggtctcttgtttttgatgaagcagtctctgaatttctgctcaaccttgtcaattgtacactttgatgtctct |
390 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28697617 |
tttggtctcttgtttttgatgaagcagtctctgaatttctgctcaaccttgtcaattgtacattttgatgtctct |
28697543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 423 - 512
Target Start/End: Complemental strand, 28697510 - 28697421
Alignment:
| Q |
423 |
ccccagctgcataggagcagcaccgttggcagatgagacagagttttcaggcaccggaggagattgaagggttgataggaaggcggtgag |
512 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28697510 |
ccccagctgcataggagcagcaccgttggcagatgagacagagttttcaggcaccggaggagattgaagggttgataggaaggcggtgag |
28697421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University