View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14428_low_14 (Length: 478)

Name: NF14428_low_14
Description: NF14428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14428_low_14
NF14428_low_14
[»] chr3 (4 HSPs)
chr3 (2-145)||(28263405-28263550)
chr3 (210-329)||(28263213-28263332)
chr3 (324-458)||(28262055-28262189)
chr3 (396-456)||(23316249-23316309)
[»] scaffold0891 (1 HSPs)
scaffold0891 (334-457)||(681-804)
[»] chr2 (3 HSPs)
chr2 (339-457)||(26602355-26602473)
chr2 (332-451)||(9586101-9586220)
chr2 (331-458)||(17639961-17640087)
[»] chr1 (3 HSPs)
chr1 (328-453)||(29213994-29214119)
chr1 (333-456)||(1034488-1034611)
chr1 (371-458)||(18301465-18301552)
[»] chr8 (3 HSPs)
chr8 (331-458)||(28744519-28744646)
chr8 (365-457)||(28641336-28641428)
chr8 (355-432)||(7636185-7636262)
[»] chr5 (1 HSPs)
chr5 (328-455)||(27316609-27316736)
[»] chr4 (2 HSPs)
chr4 (359-456)||(5408140-5408237)
chr4 (332-460)||(8690743-8690871)
[»] scaffold0081 (1 HSPs)
scaffold0081 (331-458)||(10724-10852)
[»] chr6 (1 HSPs)
chr6 (331-456)||(17261542-17261663)
[»] chr7 (1 HSPs)
chr7 (396-460)||(2938845-2938909)


Alignment Details
Target: chr3 (Bit Score: 110; Significance: 3e-55; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 2 - 145
Target Start/End: Complemental strand, 28263550 - 28263405
Alignment:
2 taaagagaaaacaccctaatcacccaaaaaatgagagaaaacaccct-atcaaaattggactggacttggattattata-tatatacaaggaaacatttt 99  Q
    ||||||||||||| ||||| ||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||||||||||    
28263550 taaagagaaaacatcctaagcacccaaaaaatgcgagaaaacacccttatcaaaattggactggacttgcattattataatatatacaaggaaacatttt 28263451  T
100 gtccaagaactttttattgcccacataatcttctcgcgcccttcaa 145  Q
    |||| |||||||||||||||||||||||||||||||||||||||||    
28263450 gtccgagaactttttattgcccacataatcttctcgcgcccttcaa 28263405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 210 - 329
Target Start/End: Complemental strand, 28263332 - 28263213
Alignment:
210 aaaggaaccaaaatttagaagaccaaaaaatttgtcattaaatcgcactatacttcaatatcaacataattcaatgcaacataaattaaaaatacaagag 309  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||    
28263332 aaaggaaccaaaacttagaagaccaaaaaatttgtcattaaatcgcactatacttcaacatcaacataattcaatgcaacataaattaaaaatataagag 28263233  T
310 gttatcgtcattacattgta 329  Q
    ||||||||||||| ||||||    
28263232 gttatcgtcattatattgta 28263213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 324 - 458
Target Start/End: Complemental strand, 28262189 - 28262055
Alignment:
324 attgtatggatggcaaaatgggttgaccccgtcaggttggcccgtttaacccgccatttttggtggggcgggttgaggttttgaacctgtcacaaatagg 423  Q
    |||||| ||||||||||||||||||  |||||||||||| ||||||||||||| ||||||||  ||||||||||||||||||||||| ||||||| ||||    
28262189 attgtagggatggcaaaatgggttggacccgtcaggttgacccgtttaacccgtcatttttgacggggcgggttgaggttttgaacccgtcacaagtagg 28262090  T
424 gtgtccgctccgcctaacccgctaaaaagcggggc 458  Q
    |||||||||||||||||||||||||||||||||||    
28262089 gtgtccgctccgcctaacccgctaaaaagcggggc 28262055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 396 - 456
Target Start/End: Original strand, 23316249 - 23316309
Alignment:
396 ttgaggttttgaacctgtcacaaatagggtgtccgctccgcctaacccgctaaaaagcggg 456  Q
    ||||| |||| |||||| || || ||||||| |||||||||||||||||||||||| ||||    
23316249 ttgagattttaaacctgacataagtagggtgcccgctccgcctaacccgctaaaaaacggg 23316309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0891 (Bit Score: 64; Significance: 9e-28; HSPs: 1)
Name: scaffold0891
Description:

Target: scaffold0891; HSP #1
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 334 - 457
Target Start/End: Original strand, 681 - 804
Alignment:
334 tggcaaaatgggttgaccccgtcaggttggcccgtttaacccgccatttttggtggggcgggttgaggttttgaacctgtcacaaatagggtgtccgctc 433  Q
    |||||||||||||||| || || ||||||||| ||||||||  |||||||| | |||| |||||||| |||||||||||  |||| |||||||||| |||    
681 tggcaaaatgggttgaaccagttaggttggcctgtttaaccaaccatttttagcggggtgggttgagattttgaacctgctacaagtagggtgtccactc 780  T
434 cgcctaacccgctaaaaagcgggg 457  Q
     |||||||||||||||||||||||    
781 tgcctaacccgctaaaaagcgggg 804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 63; Significance: 3e-27; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 339 - 457
Target Start/End: Original strand, 26602355 - 26602473
Alignment:
339 aaatgggttgaccccgtcaggttggcccgtttaacccgccatttttggtggggcgggttgaggttttgaacctgtcacaaatagggtgtccgctccgcct 438  Q
    ||||||||||  |||||| | ||||||||||||||||||||||||| |||||| ||||||||  |||||||| | ||||| ||||||| |||||| ||||    
26602355 aaatgggttggacccgtcggattggcccgtttaacccgccatttttagtggggtgggttgagaatttgaacccgccacaagtagggtgcccgctcagcct 26602454  T
439 aacccgctaaaaagcgggg 457  Q
    |||||||||||||| ||||    
26602455 aacccgctaaaaagtgggg 26602473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 332 - 451
Target Start/End: Original strand, 9586101 - 9586220
Alignment:
332 gatggcaaaatgggttgaccccgtcaggttggcccgtttaacccgccatttttggtggggcgggttgaggttttgaacctgtcacaaatagggtgtccgc 431  Q
    |||| ||||||||||||  || ||| |||||| | |||||||||||||| ||| |||||| |||||||| ||||||||  ||||  ||| | ||| ||||    
9586101 gatgtcaaaatgggttggacctgtcgggttggtcagtttaacccgccatatttagtggggtgggttgagattttgaactcgtcattaattgagtggccgc 9586200  T
432 tccgcctaacccgctaaaaa 451  Q
    |||||||||||| |||||||    
9586201 tccgcctaaccctctaaaaa 9586220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 331 - 458
Target Start/End: Original strand, 17639961 - 17640087
Alignment:
331 ggatggcaaaatgggttgaccccgtcaggttggcccgtttaacccgccatttttggtggggcgggttgaggttttgaacctgtcacaaatagggtgtccg 430  Q
    ||||||||||||||| |   |||||| ||||  |||||||||||| |||||||| |  ||| | |||||| ||||||||| |||||||  | |||| |||    
17639961 ggatggcaaaatgggctagacccgtcgggttaacccgtttaacccaccatttttagcagggtgagttgagattttgaacccgtcacaagca-ggtgcccg 17640059  T
431 ctccgcctaacccgctaaaaagcggggc 458  Q
    ||||||||||||||||||||||| ||||    
17640060 ctccgcctaacccgctaaaaagcagggc 17640087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 54; Significance: 8e-22; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 328 - 453
Target Start/End: Original strand, 29213994 - 29214119
Alignment:
328 tatggatggcaaaatgggttgaccccgtcaggttggcccgtttaacccgccatttttggtggggcgggttgaggttttgaacctgtcacaaatagggtgt 427  Q
    |||||| | |||||| |||||  |||||| |||||||||||||||||| |||||||| |  ||| |||||||| ||||||||||| ||||| || |||||    
29213994 tatggaagtcaaaataggttggacccgtcgggttggcccgtttaacccaccatttttagcagggtgggttgagattttgaacctgccacaagtaaggtgt 29214093  T
428 ccgctccgcctaacccgctaaaaagc 453  Q
    | ||||||||||||  ||||||||||    
29214094 ctgctccgcctaacttgctaaaaagc 29214119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 333 - 456
Target Start/End: Complemental strand, 1034611 - 1034488
Alignment:
333 atggcaaaatgggttgaccccgtcaggttggcccgtttaacccgccatttttggtggggcgggttgaggttttgaacctgtcacaaatagggtgtccgct 432  Q
    ||||||||||||||||   ||||| |||||| ||||||||  ||    |||| |||||| |||||||| ||||||||||| ||    ||||||||| |||    
1034611 atggcaaaatgggttggatccgtcgggttggtccgtttaattcgtttgttttagtggggtgggttgagattttgaacctgccagttgtagggtgtctgct 1034512  T
433 ccgcctaacccgctaaaaagcggg 456  Q
    |||||||| ||||||||| |||||    
1034511 ccgcctaatccgctaaaatgcggg 1034488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 371 - 458
Target Start/End: Original strand, 18301465 - 18301552
Alignment:
371 aacccgccatttttggtggggcgggttgaggttttgaacctgtcacaaatagggtgtccgctccgcctaacccgctaaaaagcggggc 458  Q
    |||||||||||||| | | || |||||||| |||| ||||   ||||  |||| || ||||||||||||||||||||||||| |||||    
18301465 aacccgccatttttagcgtggtgggttgagtttttcaacccaccacatgtaggatgcccgctccgcctaacccgctaaaaagtggggc 18301552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 52; Significance: 1e-20; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 331 - 458
Target Start/End: Original strand, 28744519 - 28744646
Alignment:
331 ggatggcaaaatgggttgaccccgtcaggttggcccgtttaacccgccatttttggtggggcgggttgaggttttgaacctgtcacaaatagggtgtccg 430  Q
    |||||||||||||| |||  |||||| | ||| || ||||||||||| |||||| | |||| |||||||| |||||||| || || || ||||||| |||    
28744519 ggatggcaaaatggattggacccgtcggattgaccggtttaacccgctatttttagcggggtgggttgagattttgaacttgccataagtagggtgcccg 28744618  T
431 ctccgcctaacccgctaaaaagcggggc 458  Q
    |||||||||||| |||||||| ||||||    
28744619 ctccgcctaacctgctaaaaaacggggc 28744646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 365 - 457
Target Start/End: Original strand, 28641336 - 28641428
Alignment:
365 ccgtttaacccgccatttttggtggggcgggttgaggttttgaacctgtcacaaatagggtgtccgctccgcctaacccgctaaaaagcgggg 457  Q
    ||||||||||||| |||||  | | || |||||||| |||||||| || || || ||||||| | |||||||||||||||||||||| |||||    
28641336 ccgtttaacccgctattttgagcgaggtgggttgagattttgaacttgccataagtagggtgcctgctccgcctaacccgctaaaaaacgggg 28641428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 355 - 432
Target Start/End: Original strand, 7636185 - 7636262
Alignment:
355 tcaggttggcccgtttaacccgccatttttggtggggcgggttgaggttttgaacctgtcacaaatagggtgtccgct 432  Q
    |||||||| ||||||||||||||| ||||  |   || |||||||| ||||||| | ||||||| |||||||||||||    
7636185 tcaggttgacccgtttaacccgcctttttgtgcaaggtgggttgagattttgaatccgtcacaagtagggtgtccgct 7636262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 328 - 455
Target Start/End: Complemental strand, 27316736 - 27316609
Alignment:
328 tatggatggcaaaatgggttgaccccgtcaggttggcccgtttaacccgccatttttggtggggcgggttgaggttttgaacctgtcacaaatagggtgt 427  Q
    ||||||||| |||||||||||| |||||| ||||||||| |||| |||| ||||||| | |||  |||||| | ||||||||| |||| || |||||||     
27316736 tatggatggtaaaatgggttgaacccgtcgggttggcccatttaccccgtcatttttagcgggatgggttgggattttgaacccgtcaaaagtagggtgc 27316637  T
428 ccgctccgcctaacccgctaaaaagcgg 455  Q
    ||  |||||||||||| |||| ||||||    
27316636 cctttccgcctaacccactaagaagcgg 27316609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 38; Significance: 0.000000000003; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 359 - 456
Target Start/End: Original strand, 5408140 - 5408237
Alignment:
359 gttggcccgtttaacccgccatttttggtggggcgggttgaggttttgaacctgtcacaaatagggtgtccgctccgcctaacccgctaaaaagcggg 456  Q
    |||| ||| ||||||||| ||||||| || | | |||||||| |||||| |||| ||  | ||| ||||||||||||||||||||| |||||||||||    
5408140 gttgacccatttaacccgtcatttttagtagagtgggttgagattttgagcctgccattagtagagtgtccgctccgcctaacccgttaaaaagcggg 5408237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 332 - 460
Target Start/End: Complemental strand, 8690871 - 8690743
Alignment:
332 gatggcaaaatgggttgaccccgtcaggttggcccgtttaacccgccatttttggtggggcgggttgaggttttgaacctgtcacaaatagggtgtccgc 431  Q
    |||| ||||||| ||||| ||||||  |||| ||  ||||||||||||||||| |  | | || ||||| |||| |||| | ||  | |||| |||||||    
8690871 gatgacaaaatgagttgaacccgtcgagttgtcctatttaacccgccatttttagcagagtggtttgagattttaaacccgccattagtaggatgtccgc 8690772  T
432 tccgcctaacccgctaaaaagcggggcag 460  Q
    |||||||||||||||||||| ||||||||    
8690771 tccgcctaacccgctaaaaaacggggcag 8690743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0081 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0081
Description:

Target: scaffold0081; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 331 - 458
Target Start/End: Complemental strand, 10852 - 10724
Alignment:
331 ggatggcaaaatgggttg-accccgtcaggttggcccgtttaacccgccatttttggtggggcgggttgaggttttgaacctgtcacaaatagggtgtcc 429  Q
    |||||||||||||||||| |   ||| ||||||||| |||||| ||| |||||||  ||||  | |||||| ||||||||| |  | || ||||||||||    
10852 ggatggcaaaatgggttggatttcgttaggttggcctgtttaatccgtcatttttaatgggatgtgttgagattttgaacccgctataagtagggtgtcc 10753  T
430 gctccgcctaacccgctaaaaagcggggc 458  Q
     ||||| ||||||| ||||||||||||||    
10752 actccgtctaaccccctaaaaagcggggc 10724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 331 - 456
Target Start/End: Complemental strand, 17261663 - 17261542
Alignment:
331 ggatggcaaaatgggttgaccccgtcaggttggcccgtttaacccgccatttttggtggggcgggttgaggttttgaacctgtcacaaatagggtgtccg 430  Q
    ||||||||||||||||||| || ||| ||||| ||||||||| ||||||||||| | |    |||||||  |||  |||| | ||||| ||||||| |||    
17261663 ggatggcaaaatgggttgaacctgtcgggttgacccgtttaatccgccatttttagcg----gggttgaaatttcaaacccgccacaagtagggtgcccg 17261568  T
431 ctccgcctaacccgctaaaaagcggg 456  Q
    || | ||||| |||||||||||||||    
17261567 cttcacctaagccgctaaaaagcggg 17261542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 396 - 460
Target Start/End: Original strand, 2938845 - 2938909
Alignment:
396 ttgaggttttgaacctgtcacaaatagggtgtccgctccgcctaacccgctaaaaagcggggcag 460  Q
    ||||| ||||||||||||| | | ||||||||||||||||||| |||| | ||||| || |||||    
2938845 ttgagattttgaacctgtccctagtagggtgtccgctccgccttacccacaaaaaaacgtggcag 2938909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University