View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14428_low_20 (Length: 406)
Name: NF14428_low_20
Description: NF14428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14428_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 19 - 393
Target Start/End: Original strand, 52301920 - 52302299
Alignment:
| Q |
19 |
actctctcaggtcctcgatgcgagatagcagcttcttccaatcttttaaccgtctgtgcaacacttctatagttcctagctgactacaaagtccacatnn |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52301920 |
actctctcaggtcctcgatgcgagatagcagcttcttccaatcttttaaccgtctgtgcaacacttctatagttcctagctgactacaaagtccacataa |
52302019 |
T |
 |
| Q |
119 |
nnnnnnnnnnnnn-----tcgattatctatactctcgtttcaaaattcaaaacactaaatagtaacttagcaagttaattagaactgcataaaccagaat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52302020 |
aaaaaaattaaaaaaaaatcgattatctatactctcgtttcaaaattcaaaacactaaatagtaacttagcaagttaattagaactgcataaaccagaat |
52302119 |
T |
 |
| Q |
214 |
tgaattaaactaatgttgcttaaattaggataataattaggcctaaaattgcaataaaatattaggaatgcggaatttacaatgcgatcatgaaggattt |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52302120 |
tgaattaaactaatgttgcttaaattaggataataattaggcctaaaattgcaataaaatattaggaatgcggaatttacaatgcgatcatgaaggattt |
52302219 |
T |
 |
| Q |
314 |
tggcgccttcagcaacggcttgaccggcgtgttgaacgacggtgtcggcgtattttttgacggtgttagtgaggttgttc |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52302220 |
tggcgccttcagcaacggcttgaccggcgtgttgaacgacggtgtcggcgtattttttgacggtgttagtgaggttgttc |
52302299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University