View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14428_low_24 (Length: 383)
Name: NF14428_low_24
Description: NF14428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14428_low_24 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 146 - 348
Target Start/End: Complemental strand, 42037270 - 42037068
Alignment:
| Q |
146 |
ccgtaagaatataatggcttagtaacacactttctaacaggttttttaatacattcttttttattggttgaaattttgcatgagagcgagtatgttactc |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42037270 |
ccgtaagaatataatggcttagtaacacactttctaacacgttttttaatacattcttttttattggttgaaattttgcatgagagcgagtatgtcactc |
42037171 |
T |
|
| Q |
246 |
tatttatctctcttcttcttatatattctcgtgattcctgctttgttttgtaaccgtttctgcatttggcacctctctctagcagctgaatggcgtctca |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42037170 |
tatttatctctcttcttcttatatattctcgtgattcctgctttgttttgtaaccgtttctgcatttggcacctctctctagcagctcaatggcgtctca |
42037071 |
T |
|
| Q |
346 |
ctc |
348 |
Q |
| |
|
||| |
|
|
| T |
42037070 |
ctc |
42037068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 27 - 72
Target Start/End: Complemental strand, 42037389 - 42037344
Alignment:
| Q |
27 |
tttgtttccctctttgtttattcacttttacaatgattaaacacta |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42037389 |
tttgtttccctctttgtttattcacttttacaatgattaaacacta |
42037344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 349 - 383
Target Start/End: Complemental strand, 35589056 - 35589022
Alignment:
| Q |
349 |
tgttatcgactgaactagaatatctcacaattagt |
383 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35589056 |
tgttatcgactaaactagaatatctcacaattagt |
35589022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University