View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14428_low_29 (Length: 344)
Name: NF14428_low_29
Description: NF14428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14428_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 14 - 330
Target Start/End: Complemental strand, 19070598 - 19070283
Alignment:
| Q |
14 |
tcatccatggatcgttcttgaatttgacgcataaatggtaccagaaaacggtaagaactttgaccataatattcgtcggtatgagaaaagtgaatgatga |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19070598 |
tcattcatggatcgttcttgaatttgacgcataaatggtaccagaaaacggtaagaacttcgaccataatattcgtcggtatgagaaaagtgaatgatga |
19070499 |
T |
 |
| Q |
114 |
gtaaagtataccaacacnnnnnnnnnnnncacttttgattttagacatggatgtacatctctgttccattgctgctgtacattgcagagcgtactctacg |
213 |
Q |
| |
|
||||||||||| |||| |||||||| ||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19070498 |
gtaaagtatactaaca-tttttttcttttcacttttggttttagacatggatgtatatctctgttccattgctgctgtatattgcagagcgtactctacg |
19070400 |
T |
 |
| Q |
214 |
aacacgtagatcgcaccattatgcagtaaaagttctcaaggtaacaaaatcacactgtctacttttaattagaactcgacttttgggaaagtttatatct |
313 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19070399 |
aacacgtagatctcaccattatgcagtaaaagttcttaaggtaacaaaatcacattgtctacttttaattagaactcgacttttgggaaagtttatatct |
19070300 |
T |
 |
| Q |
314 |
acttcgatggttcgaaa |
330 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
19070299 |
acttcgatggttcgaaa |
19070283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University