View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14428_low_30 (Length: 337)
Name: NF14428_low_30
Description: NF14428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14428_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 6e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 36784989 - 36784852
Alignment:
| Q |
1 |
cttttaaaaatattagatgtcattaagcaacactcatttataaaaataaagtgagttgcatacatcattatttcaacgttgtcagtaaaagtattattca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
36784989 |
cttttaaaaatattagatgtcattaagcaacactcatttataaaaataaagtgagttgcatagatcgttatttcaacgatgtcagtaaaagtattattca |
36784890 |
T |
 |
| Q |
101 |
acaaggtcgaatgtgttgccagtacacgtagttttgtt |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36784889 |
acaaggtcgaatgtgttgccagtacacgtagttttgtt |
36784852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 146 - 269
Target Start/End: Complemental strand, 36784770 - 36784647
Alignment:
| Q |
146 |
aatgacaatgtcttctatcttttaaagaacttctttcgttggtttctcgttagaatttggacatttataaccagggtgatgctacccaatacccatatag |
245 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36784770 |
aatgacaatgtcttctatctttcaaagaacttctttcgtcggtttctccttagaatttggacatttataaccagggtgatgctacccaatacccatatag |
36784671 |
T |
 |
| Q |
246 |
taatgggttggctttggccacccc |
269 |
Q |
| |
|
||||||| || ||||||||||||| |
|
|
| T |
36784670 |
taatggggtgactttggccacccc |
36784647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University