View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14428_low_32 (Length: 326)

Name: NF14428_low_32
Description: NF14428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14428_low_32
NF14428_low_32
[»] chr2 (2 HSPs)
chr2 (80-291)||(30392906-30393117)
chr2 (42-86)||(30392728-30392772)
[»] chr7 (1 HSPs)
chr7 (97-138)||(33472246-33472287)


Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 80 - 291
Target Start/End: Original strand, 30392906 - 30393117
Alignment:
80 gatttttatttatttttaaataggatgcggatggatctgcaacaccttaagtagattaattaaaaagaaaatttacaaaaagccggaggacatagagact 179  Q
    ||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||     
30392906 gatttttatttatttttaaataggatgcggatgaatctccaacaccttaagtagactaattaaaaagaaaatttacaaaaagccggaggacatagagacg 30393005  T
180 gaccaaatgaaagcaaaataggaacaatccaaatgggtaattcactacaactgcaaaggataaagaaatcaaaaccataaaagcaaattcaaattcagta 279  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||    
30393006 gaccaaatgaaagcaaaataggaacaatccaaatgggtaattcactacaaccgcaaaggataaagaaatcaaaaccataaaagcaaatccaaattcagta 30393105  T
280 ctagacacccac 291  Q
    ||||||||||||    
30393106 ctagacacccac 30393117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 42 - 86
Target Start/End: Original strand, 30392728 - 30392772
Alignment:
42 ggctgtattgaagaaattctcatatagcggaatggatcgattttt 86  Q
    ||||||||||||||||||||||||||| |||||||||||||||||    
30392728 ggctgtattgaagaaattctcatatagtggaatggatcgattttt 30392772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 97 - 138
Target Start/End: Complemental strand, 33472287 - 33472246
Alignment:
97 aaataggatgcggatggatctgcaacaccttaagtagattaa 138  Q
    ||||||||||| ||||||||||| |||||| |||||||||||    
33472287 aaataggatgcagatggatctgccacacctcaagtagattaa 33472246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University