View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14428_low_33 (Length: 317)
Name: NF14428_low_33
Description: NF14428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14428_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 2e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 175 - 298
Target Start/End: Original strand, 32957081 - 32957204
Alignment:
| Q |
175 |
aaggatggacctaatagtcttattgattaaatgacaaatttccattttctttttgaaatcttaggtggtcaacaccactgaaagtannnnnnnngtcaag |
274 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |||||| |||||| |
|
|
| T |
32957081 |
aaggatgaacctaatagtcttattgattaaatgacacatttccattttctttttgaaatcttaggtggtcaacatcactaaaagtattttttttgtcaag |
32957180 |
T |
|
| Q |
275 |
taatagtagctagaatttcacccg |
298 |
Q |
| |
|
|||||||||||||||||| ||||| |
|
|
| T |
32957181 |
taatagtagctagaattttacccg |
32957204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 32956890 - 32956953
Alignment:
| Q |
1 |
gtgttttgataatggccttatgacctttgcaag--acatacgtaatttatcgaactgatggaat |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32956890 |
gtgttttgataatggccttatgacctttgcaagacacatacgtaatttatcgaactgatggaat |
32956953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University