View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14428_low_34 (Length: 313)
Name: NF14428_low_34
Description: NF14428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14428_low_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 19 - 305
Target Start/End: Original strand, 54263968 - 54264253
Alignment:
| Q |
19 |
ctgttatgcagagttcccatgttttgtcggcgcatcacacttgctcggacaactttggttgttttgtgttggaattctcatctacagatgtggtaggctg |
118 |
Q |
| |
|
|||||||||||| ||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54263968 |
ctgttatgcagaattcccgtgttttgttggcgcatcacacttgctcggacaactttggttgttttgtgttggaattctcatctacagatgtggtaggctg |
54264067 |
T |
|
| Q |
119 |
agttttctagcaatgtgtggaagtttggcttgcaaaggtgtgatccgttgtttcctgcggagttgggttgcttgcatgcagagtggaagtggtggctaaa |
218 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54264068 |
agttttctagcaatatgtgggagtttggcttgcaaaggtgtgatccgttgtttcctgcggagttgggttgcttgcatgcagagtggaagtggtggctaaa |
54264167 |
T |
|
| Q |
219 |
gggatatcggtctgattgcttattggttttcattttgtggagggttgagtagtagtttgtgagggggtgggctttttgtcctttgct |
305 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54264168 |
gggatatcggtctgattgctta-tggttttcattttgtggagggttgagtagtagtttgtgagggggtgggctttttgtcctttgct |
54264253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University