View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14428_low_37 (Length: 285)
Name: NF14428_low_37
Description: NF14428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14428_low_37 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 19 - 277
Target Start/End: Original strand, 17989923 - 17990178
Alignment:
| Q |
19 |
acttttaaaacacatatatgcttctgaagggtattgatgaaaaatttagaactttgtcatatcctttcaagttaggagcgaaagaaagatgttactttta |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17989923 |
acttttaaaacacatat--gcttctgaagggtattgatgaaaattttagaactt-gtcatatcctttcaagttaggagcgaaagaaagatgttactttta |
17990019 |
T |
 |
| Q |
119 |
ggtcatgttatttatataagggatctctctaacattgtattcattctacttttcaggactttatgctggaatctaattggacaatctactagtgttgatg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17990020 |
ggtcatgttatttatataagggatctctctaacatggtattcattctacttttcaggactttatgctggaatctaattggacaatctactagtgttgatg |
17990119 |
T |
 |
| Q |
219 |
tgtcagggtcgtgtctatctatgtgcttcataggtttaaagtgcgatttggtctgtgct |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17990120 |
tgtcagggtcgtgtctatctatgtgcttcataggtttaaagtgcgatttggtctgtgct |
17990178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 262
Target Start/End: Original strand, 17990437 - 17990470
Alignment:
| Q |
229 |
gtgtctatctatgtgcttcataggtttaaagtgc |
262 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
17990437 |
gtgtctatctatgtgcttcataggtttgaagtgc |
17990470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University