View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14428_low_47 (Length: 250)
Name: NF14428_low_47
Description: NF14428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14428_low_47 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 35226652 - 35226403
Alignment:
| Q |
1 |
tgaagctgaggattcagtttctccggttgatactactgcagatgactattatgctgttcttggtctggtaatacatcaaattatgtcttcttttgtcatt |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35226652 |
tgaagctgaggattcagtttatccggttgatactactgcagatgactattatgctgttcttggtctggtaatacatcaaattatgtcttcttttgtcatt |
35226553 |
T |
 |
| Q |
101 |
ttctgcaaaaatagtttatgctttcattaataattatgtttgatcttattgtttttcttataggctgatgtatagttagacccttttgttaagttgggtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35226552 |
ttctgcaaaaatagtttatgctttcattaataattatgtttgatcttattgtttttcttataggctgatgtatagttagacccttttgttaagttgggtg |
35226453 |
T |
 |
| Q |
201 |
taatttgattaatcttatgtgtattaagatatagagatgtgttattttga |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35226452 |
taatttgattaatcttatgtgtattaagatatagagatgtgttattttga |
35226403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University