View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14428_low_49 (Length: 246)
Name: NF14428_low_49
Description: NF14428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14428_low_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 48016812 - 48016586
Alignment:
| Q |
1 |
agtgattttctcatctccagcaactgtggcaattatagttgcttacttcttggatgccactatgaaccgtgaacacgcctcaactcaccgtgacagtggg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48016812 |
agtgattttctcatctccagcaactgtggcaattatagttgcttacttcttggatgccactatgagtcgtgaacacgcctcaactcaccgtgacagtggg |
48016713 |
T |
|
| Q |
101 |
agacactggtgggaaaaattcaggaccttcaatcaggatatcagaagtgatgagttctatggattgcctatgaatctgaacagatttttcccttcagcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
48016712 |
agacactggtgggaaaaattcaggaccttcaatcaggatatcagaagtgatgagttctatggattgcctatgaatctgaacagatttttcccttcagcat |
48016613 |
T |
|
| Q |
201 |
aaatgcactcatttatttcaaaagaac |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
48016612 |
aaatgcactcatttatttcaaaagaac |
48016586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University