View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14428_low_50 (Length: 246)

Name: NF14428_low_50
Description: NF14428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14428_low_50
NF14428_low_50
[»] chr6 (3 HSPs)
chr6 (18-183)||(21274938-21275103)
chr6 (128-190)||(21110129-21110187)
chr6 (108-180)||(21177993-21178065)


Alignment Details
Target: chr6 (Bit Score: 126; Significance: 4e-65; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 18 - 183
Target Start/End: Complemental strand, 21275103 - 21274938
Alignment:
18 gtcacgatgtccatgtcaatatcatgtttgtttaccgattaacaagcaacagaaatgtcgaagacaatttaacttcatttgaaatataacttctacattt 117  Q
    ||||||||||  |||| |||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |||||    
21275103 gtcacgatgtttatgttaatatcatgtttgtttacggattaacaagcaatagaaatgtcgaagacaatttaacttcattagaaatataacttctgcattt 21275004  T
118 cctcttgagtaattaatttctctttccttttatgtaacctcaaatgaatgattgccaatgcatgtt 183  Q
    |||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |||||    
21275003 cctcttgagtaattaatttctctttccttttatgtaaccttaaatgattgattgccaatgtatgtt 21274938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 128 - 190
Target Start/End: Complemental strand, 21110187 - 21110129
Alignment:
128 aattaatttctctttccttttatgtaacctcaaatgaatgattgccaatgcatgtttgatagt 190  Q
    |||| ||||||||||||||||||||||||||||    ||||||| |||| |||||||||||||    
21110187 aattgatttctctttccttttatgtaacctcaa----atgattgtcaatacatgtttgatagt 21110129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 180
Target Start/End: Complemental strand, 21178065 - 21177993
Alignment:
108 ttctacatttcctcttgagtaattaatttctctttccttttatgtaacctcaaatgaatgattgccaatgcat 180  Q
    ||||||||||||| || |  ||||||||||  ||||||| |||||||||||||| || || ||||||||||||    
21178065 ttctacatttcctattaacaaattaatttcaatttccttctatgtaacctcaaacgattgcttgccaatgcat 21177993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University