View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14428_low_57 (Length: 231)
Name: NF14428_low_57
Description: NF14428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14428_low_57 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 4663263 - 4663477
Alignment:
| Q |
1 |
attggttgggaatcactttagttatgcttggtagtttattcatcttgttcagtctgtttatatcaatttatcccaagcgtttagcaaggaatagttggtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
4663263 |
attggttgggaatcactttagttatgcttggtagtttattcatcttgttcagtctatttatatcaatttatcccaagcgtttagcaaggaatagttagtt |
4663362 |
T |
 |
| Q |
101 |
atgcttgtaatttggaactagctgttcttttcacatacaaaaattaagttatcgaggattatttgtataagcatatgtttgttgttactaaattataagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| || |
|
|
| T |
4663363 |
atgcttgtaatttggaactagctgttcttttcacatacaaaaattaagttatcgaggattatttgtataagcatatgcttgttgttactaaattatatgt |
4663462 |
T |
 |
| Q |
201 |
tagtagtcagatttg |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
4663463 |
tagtagtcagatttg |
4663477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University