View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14428_low_58 (Length: 217)
Name: NF14428_low_58
Description: NF14428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14428_low_58 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 51 - 204
Target Start/End: Complemental strand, 1521516 - 1521364
Alignment:
| Q |
51 |
atattcaaacgttataacaataaatattttcattagttttgatatgttttccgttttcttttaataat---tggtattaatattgaccatagacctaacc |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1521516 |
atattcaaacgttataacaataaatattttcattagttttgatatgttttccgttttcttttaataataattggtattaatattgaccatagacctaacc |
1521417 |
T |
 |
| Q |
148 |
atgtatactataacgttcgtaacagtcagtccggcaacaaaattcacatgtattatg |
204 |
Q |
| |
|
||| ||||||||||||||||||||||| | | |||||||||||||||||||||| |
|
|
| T |
1521416 |
atgcatactataacgttcgtaacagtc----cagtaacaaaattcacatgtattatg |
1521364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University