View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14428_low_59 (Length: 216)
Name: NF14428_low_59
Description: NF14428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14428_low_59 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 3e-47; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 27 - 141
Target Start/End: Complemental strand, 18346879 - 18346764
Alignment:
| Q |
27 |
cttgatactcttgctacaaacaaattaaggttacctaattatagatttgtatattactaaggaggtcttggtttggtcccct-ctttcttttggtttttc |
125 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
18346879 |
cttgatactcttgctacaaacaaattagggttacctaattatagatttgtatattactaaggaggtcttcgtttggtcccctcctttcttttggtttttc |
18346780 |
T |
 |
| Q |
126 |
atctttcttattatat |
141 |
Q |
| |
|
|||||| ||||||||| |
|
|
| T |
18346779 |
atcttttttattatat |
18346764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 37 - 141
Target Start/End: Original strand, 18348959 - 18349065
Alignment:
| Q |
37 |
ttgctacaaacaaattaaggttacctaattatagatttgtatattactaaggaggtcttggtttggtcccc--tctttcttttggtttttcatctttctt |
134 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |||||||||||||| ||||| |||||||||||| ||||||| |
|
|
| T |
18348959 |
ttgctacaaacaaattagggttacctaattatagatttgtacattactaaggaggtgttggtttggtccccctcctttcatttggtttttcaactttctt |
18349058 |
T |
 |
| Q |
135 |
attatat |
141 |
Q |
| |
|
||||||| |
|
|
| T |
18349059 |
attatat |
18349065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 150 - 208
Target Start/End: Complemental strand, 18346709 - 18346653
Alignment:
| Q |
150 |
attaatacatgcattgaatctcaaataattgtcatatacattgaccaacagtattatct |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
18346709 |
attaatacatgcattgaatctcaaataattgtcatat--attgaccaacaatattatct |
18346653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 40543851 - 40543792
Alignment:
| Q |
48 |
aaattaaggttacctaattatagatttgtatattactaaggaggtcttggtttggtcccc |
107 |
Q |
| |
|
|||||| |||||||||||||||| |||||| ||||||| ||||||||||||||| ||||| |
|
|
| T |
40543851 |
aaattagggttacctaattataggtttgtaaattactagggaggtcttggtttgatcccc |
40543792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University