View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14429_high_13 (Length: 261)
Name: NF14429_high_13
Description: NF14429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14429_high_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 150 - 243
Target Start/End: Original strand, 20717247 - 20717340
Alignment:
| Q |
150 |
taatttgaagttagatagtaggttttttcttgttgtgatattgggtgaatgttgatcccttgccccgtaagagacaatattttttaggtcacta |
243 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
20717247 |
taatttgaagttagaaagtaggttttttcttgttgtgatattgggtgaatgttgatcccttgccccgtaagggacaatcttttttaggtcacta |
20717340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 23 - 60
Target Start/End: Original strand, 20717162 - 20717201
Alignment:
| Q |
23 |
gtattgagactttgttgt--gtttgaaatgtagagaatag |
60 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20717162 |
gtattgagactttgttgtttgtttgaaatgtagagaatag |
20717201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University