View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14429_low_13 (Length: 261)

Name: NF14429_low_13
Description: NF14429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14429_low_13
NF14429_low_13
[»] chr6 (2 HSPs)
chr6 (150-243)||(20717247-20717340)
chr6 (23-60)||(20717162-20717201)


Alignment Details
Target: chr6 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 150 - 243
Target Start/End: Original strand, 20717247 - 20717340
Alignment:
150 taatttgaagttagatagtaggttttttcttgttgtgatattgggtgaatgttgatcccttgccccgtaagagacaatattttttaggtcacta 243  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||    
20717247 taatttgaagttagaaagtaggttttttcttgttgtgatattgggtgaatgttgatcccttgccccgtaagggacaatcttttttaggtcacta 20717340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 23 - 60
Target Start/End: Original strand, 20717162 - 20717201
Alignment:
23 gtattgagactttgttgt--gtttgaaatgtagagaatag 60  Q
    ||||||||||||||||||  ||||||||||||||||||||    
20717162 gtattgagactttgttgtttgtttgaaatgtagagaatag 20717201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University