View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1442R-Insertion-1 (Length: 152)
Name: NF1442R-Insertion-1
Description: NF1442R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1442R-Insertion-1 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 1e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 1e-76
Query Start/End: Original strand, 8 - 152
Target Start/End: Original strand, 414457 - 414601
Alignment:
| Q |
8 |
agctgattgcaaagaaagattggttagagcgcacaatgagtctaccaagatatctcaaatagtcaaagatgccaaatctaaagtcagacgatttcttgac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
414457 |
agctgattgcaaagaaagattggttagagcgcacaatgagtctaccaagatatctcaaatagtcaaagatgccaaatctaaagtcagacgatttcttgac |
414556 |
T |
|
| Q |
108 |
tgctcacttattgatgatttgctttagtatgttgcaatttcatct |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
414557 |
tgctcacttattgatgatttgctttagtatgttgcaatttcatct |
414601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 68; Significance: 1e-30; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 9 - 148
Target Start/End: Complemental strand, 37211762 - 37211623
Alignment:
| Q |
9 |
gctgattgcaaagaaagattggttagagcgcacaatgagtctaccaagatatctcaaatagtcaaagatgccaaatctaaagtcagacgatttcttgact |
108 |
Q |
| |
|
|||||||| ||||| |||||| |||| ||| ||||||||||||| | |||||||| ||| ||||||| |||||||||||||||||||||| |||| | |
|
|
| T |
37211762 |
gctgattggaaagagagattgactagaatgcaggatgagtctaccaaaacatctcaaagagtaaaagatgtcaaatctaaagtcagacgatttgttgatt |
37211663 |
T |
|
| Q |
109 |
gctcacttattgatgatttgctttagtatgttgcaatttc |
148 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||| |||||| |
|
|
| T |
37211662 |
gctcactaattgatggtttgctttagtatgttgtaatttc |
37211623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 6e-26
Query Start/End: Original strand, 9 - 152
Target Start/End: Complemental strand, 37217444 - 37217301
Alignment:
| Q |
9 |
gctgattgcaaagaaagattggttagagcgcacaatgagtctaccaagatatctcaaatagtcaaagatgccaaatctaaagtcagacgatttcttgact |
108 |
Q |
| |
|
|||||||| ||| | |||||||||||| ||| ||||||||||||||| || ||| | ||||||||| ||||||||||||||||| ||||||| | |
|
|
| T |
37217444 |
gctgattggaaaaagagattggttagaatgcatgatgagtctaccaagacattcaaaagaatcaaagatggcaaatctaaagtcagacaatttcttaatg |
37217345 |
T |
|
| Q |
109 |
gctcacttattgatgatttgctttagtatgttgcaatttcatct |
152 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37217344 |
gctcactggttgatgatttgatttagtatgttgcaatttcatct |
37217301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University