View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1442R-Insertion-2 (Length: 170)
Name: NF1442R-Insertion-2
Description: NF1442R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1442R-Insertion-2 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 1e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 1e-79
Query Start/End: Original strand, 9 - 170
Target Start/End: Original strand, 13114753 - 13114914
Alignment:
| Q |
9 |
ctttggtgagggatttttgggcccagccccatttttatccagatccttctcgacccatatcatatgactccacgccatatacttgtcaactgcgccaagt |
108 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
13114753 |
ctttggtgaggaatttttgggcccagccccatttttatccagatccttctcgacccatatcatatgactccacgccatatacttgtcaactgcgccgagt |
13114852 |
T |
|
| Q |
109 |
aaaatggaccataggtcgagtaatcttcaaaaggttataatgccgccaattctaaacctaag |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13114853 |
aaaatggaccataggtcgagtaatcttcaaaaggttataatgcagccaattctaaacctaag |
13114914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University