View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1442R-Insertion-3 (Length: 200)
Name: NF1442R-Insertion-3
Description: NF1442R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1442R-Insertion-3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 9 - 115
Target Start/End: Complemental strand, 43924651 - 43924542
Alignment:
| Q |
9 |
gaatttagttcaccccatgtttctttgtcctcgcagcatcatcatctcattcacaccatcttcctcctc---ctccgttaacaacgtaacattcactcac |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
43924651 |
gaatttagttcaccccatgtttctttgtccccgcagcatcatcatctcattcacaccatcttcctcctcctcctccgttaacaacttaacattcactcac |
43924552 |
T |
 |
| Q |
106 |
caccaaaacg |
115 |
Q |
| |
|
|||||||||| |
|
|
| T |
43924551 |
caccaaaacg |
43924542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 150 - 189
Target Start/End: Complemental strand, 43924516 - 43924477
Alignment:
| Q |
150 |
accaaaatttgttcacactactcgtacccattcacattct |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43924516 |
accaaaatttgttcacactactcgtacccattcacattct |
43924477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University