View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1442R-Insertion-4 (Length: 213)
Name: NF1442R-Insertion-4
Description: NF1442R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1442R-Insertion-4 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 9 - 213
Target Start/End: Complemental strand, 2064923 - 2064719
Alignment:
| Q |
9 |
gtaatccatctccaacaaccaccgaacctcctcctcacactcacagccgtcgtatctctccagaaacaacacctccctccgtcatcgactcactccctct |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2064923 |
gtaatccatctccaacaaccaccgaacctcctcctcacactcacagccgtcgtatctctccagaaacaacacctccctccgtcatcgactcactccctct |
2064824 |
T |
 |
| Q |
109 |
cttcacattctcatccatctcccgtcgttcctccgccgtcaccgccgctgattgcgctgtctgtttatcaaagttccgtaactccgacctcctccgttct |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2064823 |
cttcacattctcatccatctcccgtcgttcctccgccgtcaccgccgctgactgcgctgtctgtttatcaaagttccgtaactccgacctcctccgttct |
2064724 |
T |
 |
| Q |
209 |
cttcc |
213 |
Q |
| |
|
||||| |
|
|
| T |
2064723 |
cttcc |
2064719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University