View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1442_high_14 (Length: 234)
Name: NF1442_high_14
Description: NF1442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1442_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 218
Target Start/End: Original strand, 3982202 - 3982404
Alignment:
| Q |
16 |
ataaccaacgctcttataagtagtatcactgaaggtggcgcgaaaatcaaaatgtggtgaaaattgaaagcacacaacaatggaagacgacggtggagaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3982202 |
ataaccaacgctcttataagtagtatcactgaaggtggcgcgaaaatcaaaatgtggtgaaaattgaaagcacacaacaatggaaaacgacggtggagaa |
3982301 |
T |
 |
| Q |
116 |
ggttcaagcttccttgtcagcatcattgaaaacagagctaaagaggtttcaatcttcaatactcagttcaattagttttcatgcaataatggaatcataa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3982302 |
ggttcaagcttccttgtcagcatcattgaaaacagagctaaggaggtttcaatcttcaatactcagttcaattagttttcatgcaataatggaatcataa |
3982401 |
T |
 |
| Q |
216 |
tct |
218 |
Q |
| |
|
||| |
|
|
| T |
3982402 |
tct |
3982404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University