View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1442_high_9 (Length: 252)
Name: NF1442_high_9
Description: NF1442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1442_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 9 - 236
Target Start/End: Complemental strand, 31548349 - 31548125
Alignment:
| Q |
9 |
ttgtatagcatttttcacatttttccttggatttctttggttctgatctatcaatgctacatataaggcacatgtcagttatgctgcaattcaaatatgt |
108 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| ||||||||||| |
|
|
| T |
31548349 |
ttgtatatcatttttcacatttttccttggatttctttggttctgatctatcaatgctacatataaggcacgtctcagttatgctgctattcaaatatgc |
31548250 |
T |
 |
| Q |
109 |
atgtttttaaatcaatatgcatacatacacattaaccattggaatttattctgaaatacgatg-ttttcattttaggtttgcatctttgcctatggtcaa |
207 |
Q |
| |
|
||| |||||||||||| |||||||||||||||||||| | ||||||||||||||| || | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31548249 |
atg----taaatcaatatggatacatacacattaaccatttggatttattctgaaatatgaagtttttcattttaggtttgcatctttgcctatggtcaa |
31548154 |
T |
 |
| Q |
208 |
acaggatcagggaaaacctatacaatgat |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31548153 |
acaggatcagggaaaacctatacaatgat |
31548125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 182 - 236
Target Start/End: Original strand, 34651119 - 34651173
Alignment:
| Q |
182 |
aggtttgcatctttgcctatggtcaaacaggatcagggaaaacctatacaatgat |
236 |
Q |
| |
|
|||||||||| || || |||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
34651119 |
aggtttgcattttcgcatatggtcagacaggttcagggaaaacctatacaatgat |
34651173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University