View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1442_low_11 (Length: 284)
Name: NF1442_low_11
Description: NF1442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1442_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 276
Target Start/End: Original strand, 31548409 - 31548677
Alignment:
| Q |
1 |
tgtgaaacttctacaaaaacttcttcttgtgatacgtcttgtataaaaactttatcaaatttaaaagaatgcttctggcctaaaaacaaaataggagtca |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31548409 |
tgtgaaacttctacaaacacttcttcttgtgatatgtcttgtataaaaactttatcaaatttaaaagaatgcttctggcctaaaaacaaaataggagtca |
31548508 |
T |
 |
| Q |
101 |
catgagttgccaatttaataagatcataactaaaacaatcatagaaaaataagaaaaattatactttcaagtttcaaatacatcatcataacagatatac |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
31548509 |
cacgagttgccaatttaataagatcataactaaaacaatcatagaaaaataagaaaaattatac-------tttcaaatacatcatcacaacagatatac |
31548601 |
T |
 |
| Q |
201 |
cattttgggctaggtcaattcctcgtccagaactttccattgataatggataactgaatatcttgccttctgtgct |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31548602 |
cattttgggctaggtcaattcctcgtccagaagtttccattgatgatggataactgaatatcttgccttctgtgct |
31548677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University