View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1442_low_16 (Length: 240)
Name: NF1442_low_16
Description: NF1442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1442_low_16 |
 |  |
|
| [»] chr6 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 70; Significance: 1e-31; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 159 - 240
Target Start/End: Original strand, 26570351 - 26570431
Alignment:
| Q |
159 |
gaagacatgcatttatttgacaaagtaattaagtttcctagctattatttagtattagaatataagtgaggattagggttta |
240 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26570351 |
gaaggcatgcatttatttgacaaagtaattaagtttcctagctattatttagta-tagaatataagtgaggattagggttta |
26570431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 26569685 - 26569766
Alignment:
| Q |
1 |
ttatactaactcagttaaattgatattagggagaatcgaaactataaccttgatgaggaactcacttgctttatattattaa |
82 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
26569685 |
ttatactaactcagttaaattgatatcagggagaatcgaaactgtaactttgatgaggaactcaattgctttatattattaa |
26569766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 74 - 125
Target Start/End: Original strand, 26570266 - 26570317
Alignment:
| Q |
74 |
tattattaatatgttgtaccaagtaaatctcaaatgtccaaatttgaaatta |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26570266 |
tattattaatatgttgtaccaagtaaatctcaaatgtccaaatttgaaatta |
26570317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University