View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1442_low_16 (Length: 240)

Name: NF1442_low_16
Description: NF1442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1442_low_16
NF1442_low_16
[»] chr6 (3 HSPs)
chr6 (159-240)||(26570351-26570431)
chr6 (1-82)||(26569685-26569766)
chr6 (74-125)||(26570266-26570317)


Alignment Details
Target: chr6 (Bit Score: 70; Significance: 1e-31; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 159 - 240
Target Start/End: Original strand, 26570351 - 26570431
Alignment:
159 gaagacatgcatttatttgacaaagtaattaagtttcctagctattatttagtattagaatataagtgaggattagggttta 240  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
26570351 gaaggcatgcatttatttgacaaagtaattaagtttcctagctattatttagta-tagaatataagtgaggattagggttta 26570431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 26569685 - 26569766
Alignment:
1 ttatactaactcagttaaattgatattagggagaatcgaaactataaccttgatgaggaactcacttgctttatattattaa 82  Q
    |||||||||||||||||||||||||| |||||||||||||||| |||| ||||||||||||||| |||||||||||||||||    
26569685 ttatactaactcagttaaattgatatcagggagaatcgaaactgtaactttgatgaggaactcaattgctttatattattaa 26569766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 74 - 125
Target Start/End: Original strand, 26570266 - 26570317
Alignment:
74 tattattaatatgttgtaccaagtaaatctcaaatgtccaaatttgaaatta 125  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
26570266 tattattaatatgttgtaccaagtaaatctcaaatgtccaaatttgaaatta 26570317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University