View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1442_low_20 (Length: 214)
Name: NF1442_low_20
Description: NF1442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1442_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 18 - 198
Target Start/End: Original strand, 38038697 - 38038878
Alignment:
| Q |
18 |
catgtgtgctctatagttgaaagattaataaactaaactttatatctctcatgtagatcatataaactgtgttgaggccaacagtgatgagttcaatcgt |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38038697 |
catgtgtgctctatagttgaaagataaataaactaaactttatatctctcatgtagatcatataaactgtgttgaggccaacagtgatgagttcaatcgt |
38038796 |
T |
|
| Q |
118 |
gaatctttttgtggaaaaagatgtcaacaggtatgata-nnnnnnnncatattttaaaatcttgaacattgttcttaatttt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38038797 |
gaatctttttgtggaaaaagatgtcaacaggtatgatatttttttttcatattttaaaatcttgaacattgttcttaatttt |
38038878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University