View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1442_low_22 (Length: 201)
Name: NF1442_low_22
Description: NF1442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1442_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 3 - 194
Target Start/End: Complemental strand, 53096276 - 53096085
Alignment:
| Q |
3 |
agaaatggaaatagttttgatgttggaacagttcattctgctagtttggacatttttcctgaaactaaaaatggtattcttcagcagcagtgccattatc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53096276 |
agaaatggaaatagttttgatgttggaacagttcattctgctagtttggacatttttcctgaaactaaaaatggtattcttcagcagcagtgccattatc |
53096177 |
T |
|
| Q |
103 |
ttgacatatctctctctaaggatcctccgatgcctgcaaaatgtgatcctctaaagcaagtaagcttatgaatgcttttggtgatgatgtcc |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
53096176 |
ttgacatatctctctctaaggatcctccgatgcctgcaaaatgtgatcctctaaagcaagtaagcttatgaatgcttttggtaatgatgtcc |
53096085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 3 - 55
Target Start/End: Original strand, 1369431 - 1369483
Alignment:
| Q |
3 |
agaaatggaaatagttttgatgttggaacagttcattctgctagtttggacat |
55 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| || ||||||||||||| |
|
|
| T |
1369431 |
agaaatggaaatagttttgatgctggaacagttcatactactagtttggacat |
1369483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University