View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14430_low_1 (Length: 388)
Name: NF14430_low_1
Description: NF14430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14430_low_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 19 - 371
Target Start/End: Original strand, 8301240 - 8301586
Alignment:
| Q |
19 |
cttagtggaccaccatttttgctttttatgtctgtttagtttttcataattctctaggcatagaataaggagctcagctcagtggattagttagaaaatt |
118 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||| ||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8301240 |
cttagtggaccaccatttttgccttttgtgtctgtttagtttttcataattcgctaagcatagaataagg------gctcagtggattagttagaaaatt |
8301333 |
T |
|
| Q |
119 |
taactttctggatttttcagacccgctaagcatcacctttattcttagtgaatttgacagaacctaaacaatagttttcttggttatgtcaaattttcct |
218 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8301334 |
taactttctggatttttcagactcgctaagcatcacctttattcttagtgaatttgacagaacctaaacaatagttttcttggttgtgtcaaattttcct |
8301433 |
T |
|
| Q |
219 |
acttttattatcacacatatcaatctatattcctagaattaatatcatactaatctacactagcatacaaactacacaatnnnnnnnngttaaggggtac |
318 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8301434 |
acttttattatcacacatattaatctatattcctagaattaatatcatactaatctacactagcatacaaactacacaataaaaaaaagttaaggggtaa |
8301533 |
T |
|
| Q |
319 |
gaaaattgggctgcctccgaataagagcttgtttaacgtcaatttagcttgac |
371 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8301534 |
gaaaattgggttgcctccgaataagagcttgtttaacgtcaatttagcttgac |
8301586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University