View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14431_high_8 (Length: 279)
Name: NF14431_high_8
Description: NF14431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14431_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 36886282 - 36886103
Alignment:
| Q |
1 |
atgtatggcttcttcttttggattttttgatatcacagtacgatttaaataaaatgaataggtgactaaaccagtacaaaactttagatacttgaatcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36886282 |
atgtatggcttcttcttttggattttttgatatcacagtacgatttaaataaaatgaataggtgactaaaccagtacaaaactttagatacttgaatcct |
36886183 |
T |
|
| Q |
101 |
tgaaattttttggatctgtgaaagcaaaccatgaatgcaatctgaacttttccaaataaggatcaaataatatgtgcaac |
180 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36886182 |
tgaaattttatggatctgtgaaagcaaaccatgaatgcaatctgaacttttccaaataaggatcaaataatatgtgcaac |
36886103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University