View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14431_low_9 (Length: 279)

Name: NF14431_low_9
Description: NF14431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14431_low_9
NF14431_low_9
[»] chr7 (1 HSPs)
chr7 (1-180)||(36886103-36886282)


Alignment Details
Target: chr7 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 36886282 - 36886103
Alignment:
1 atgtatggcttcttcttttggattttttgatatcacagtacgatttaaataaaatgaataggtgactaaaccagtacaaaactttagatacttgaatcct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36886282 atgtatggcttcttcttttggattttttgatatcacagtacgatttaaataaaatgaataggtgactaaaccagtacaaaactttagatacttgaatcct 36886183  T
101 tgaaattttttggatctgtgaaagcaaaccatgaatgcaatctgaacttttccaaataaggatcaaataatatgtgcaac 180  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36886182 tgaaattttatggatctgtgaaagcaaaccatgaatgcaatctgaacttttccaaataaggatcaaataatatgtgcaac 36886103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University