View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14432_low_8 (Length: 328)
Name: NF14432_low_8
Description: NF14432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14432_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 34051225 - 34051017
Alignment:
| Q |
1 |
tgatatgttttggctaagaatgtaaatgtggaccnnnnnnngaaggaattgaatgagatgaaaaaatatggaagatggcattgttataaagggtctgtat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34051225 |
tgatatgttttggctaagaatgtaaatgtggaccaaaaaaagaaggaattgaatgtgatgaaaaaatatggaagatggcattgttataaagggtttgtat |
34051126 |
T |
|
| Q |
101 |
gtgtgaagagataggggatagttgatacaactaccccaacgaacttttaattgttatatgtgtgggcattgaattagccaactgggaaacagccttataa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34051125 |
gtgtgaagagataggggatagttgatacaactaccccaacgaacttttaattgtaatatgtgtgggcattgaattagccaactgggaaacagccttataa |
34051026 |
T |
|
| Q |
201 |
attatatat |
209 |
Q |
| |
|
||| ||||| |
|
|
| T |
34051025 |
attttatat |
34051017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University