View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14433_high_18 (Length: 257)
Name: NF14433_high_18
Description: NF14433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14433_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 62 - 158
Target Start/End: Complemental strand, 5458965 - 5458870
Alignment:
| Q |
62 |
atgcagtgtgtgattggacaagcactgaacccaaatgttgatggcagcgaatgaaccaagatactttgagaaaagtatttatttgatttacatatag |
158 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5458965 |
atgcagtgtgtgatttgacaagcactgaacccaaatgttgatggcagcgaatgaaccaagatactttgagaaaagtattta-ttgatttacatatag |
5458870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 177 - 239
Target Start/End: Complemental strand, 5458687 - 5458625
Alignment:
| Q |
177 |
tcggaaaagaaatcatcaagtattttgggagtatgttcagtgttcttggttttctcattgcct |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5458687 |
tcggaaaagaaatcatcaagtattttgggagtatgttcagtgttcttggttttctcattgcct |
5458625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 193 - 242
Target Start/End: Original strand, 16465654 - 16465703
Alignment:
| Q |
193 |
caagtattttgggagtatgttcagtgttcttggttttctcattgcctttg |
242 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
16465654 |
caagtattttgggagtatgttcagtattcatggttttctcattgcctttg |
16465703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University