View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14433_high_20 (Length: 250)
Name: NF14433_high_20
Description: NF14433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14433_high_20 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 15 - 250
Target Start/End: Original strand, 42695448 - 42695683
Alignment:
| Q |
15 |
aatatctgacatatttccaccactcatggtgatacactaggttttgacaaaactatcatataattcttttctcttttatcagattgatattatttattta |
114 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42695448 |
aatatctgacatatttccaccactcatagtgatacactaggttttgacaaaactatcatataattcttttctcttttatcagattgatattatttattta |
42695547 |
T |
|
| Q |
115 |
ttttataaatgatttagttcaagaatgagtatttggtatgttacctaggataataaggtttctttggtctcaaatggaatgactatatgatcgggtatgt |
214 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42695548 |
ttgtataaatgatttagttcaagaatgagtatttggtatgttacctaggataataaggtttctttggtctcaaatggaatgactatatgatcgggtatgt |
42695647 |
T |
|
| Q |
215 |
tacctaggaataggataataagccttctttggtctc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
42695648 |
tacctaggaataggataataagccttctttggtctc |
42695683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 160 - 204
Target Start/End: Original strand, 42695658 - 42695702
Alignment:
| Q |
160 |
taggataataaggtttctttggtctcaaatggaatgactatatga |
204 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
42695658 |
taggataataagccttctttggtctcaaattgaatgactatatga |
42695702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University